So the next time someone says “bioinformatics,” don’t just think “DNA and computers.” Think: a cosmic librarian, a codebreaker, a time traveler reading the oldest story ever told — written in a language of four letters, hidden inside every cell of your body.
Here’s an interesting, engaging piece on — written to be accessible yet thought-provoking. The Secret Decoder Ring of Life: An Introduction to Bioinformatics Imagine you’re handed a library. Not a small town library, but a cosmic one. Billions of volumes. Each book is written in the same four-letter alphabet — A, C, G, T — but the sentences stretch for millions of characters. Every book tells a different story: how to build a frog, a redwood tree, a bacterium that lives in boiling acid, or you . Introduction to Bioinformatics
ATGCGTACGTAGCTAGCTAGCTAGCATCGATCGATCGATCG So the next time someone says “bioinformatics,” don’t